Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SwapAtom

-

Swap chemical element of atoms


CommandArgumentDatatypeDefault Min Max
Format: SwapAtom Atom selection,SELECTION ---
   Element = New element name or number, STRING-- -
   update = Yes | NoSTRINGYes - -
Python: SwapAtom(selection1,element,update=None)
Menu:Edit > Swap > Atom
Related: SwapObj , SwapRes, SwapPosAtom
Required:


The SwapAtom command swaps the chemical element of the selected atoms.

If the update flag is set, SwapAtom will also update the bond lengths and hydrogen atoms to match the new element. This makes building of small chemical modifications very easy. E.g. to protect a hydroxyl group with a methyl, just swap the hydroxyl hydrogen to a carbon.

If the atom to be swapped is a hydrogen, YASARA will look at the bound heavy atom and set the bond order between them to the highest possible value found at the bound heavy atom. The details are explained in the YASARA movie 'Building small molecules'.

Example 1:
SwapAtom 115,Oxygen

Turn atom number 115 into an oxygen atom.


Example 2:
SwapAtom Na,Cl

Turn all sodium into chloride atoms.


Example 3:
SwapAtom 6,1,update=No

Turn atom number six into a hydrogen atom, and do not update bond lengths and other hydrogens around.