Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SurfPar

-

Set/get surface parameters


CommandArgument DatatypeDefaultMinMax
Format:SurfParProbe = Water probe radius in Å,FLOAT -0.03.0
   Resolution = Grid resolution,INT-1 6
   Molecular = Algorithm used for molecular surface [Numeric | Gaussian | Analytic | AnalyticDraft],STRING ---
   ESPMax = Maximum absolute potential*unit charge used for coloring surfaces by electrostatic potential in EnergyUnits,FLOAT - --
  SmoothCut = Yes | No,STRING - --
  Radii = VdW | SolvationSTRING - --
Python:SurfPar(probe,resolution,molecular,espmax,smoothcut,radii)
resultlist = SurfPar()
Menu:View > Show surface > Parameters
Related:ShowSurf , HideSurf, ColorSurf , AddEnv, RemoveEnv
Required:


The SurfPar command adjusts various surface related parameters, that influence all surfaces together:

  • Probe: The radius of the water probe that traces the surface, normally 1.4 A.
  • Resolution: The surface resolution in arbitrary units, like in X-ray crystallography smaller numbers mean higher resolution (and also slower graphics).
  • Molecular: The algorithm used to calculate molecular surfaces. The default is YASARA's fast and accurate 'Numeric' algorithm. If speed is an issue, the even faster 'Gaussian' approximation can be selected, whose results differ by about 1.5%. Alternatively, 'Analytic' employs the MSMS program. Since MSMS calculates only one surface per object and thus does not include cavities and detached molecules, it should only be used for visualization.
  • ESPMax: The absolute electrostatic potential required to reach the maximum coloring (i.e. completely red for negative and completely blue for positive potentials). To keep the values tractable, ESPMax is actually specified in the current EnergyUnit, hence either in kcal/mol or kJ/mol and thus indicates the potential energy of an elementary charge +e at a given surface point. More details about the way the electrostatic potential is calculated can be found here.
  • Radii: The set of atomic radii used for calculating molecular and solvent accessible surfaces. Either the normal 'VdW' radii, or the more realistic effective 'Solvation' radii. The latter consider the fact that water molecules forming hydrogen bonds with the solute can get significantly closer than the normal VdW surface. The solvation radii have been extracted from molecular dynamics simulations. For optimal results, the radius of the solvent probe must be set to 1.4 A.

To calculate the molecular surface analytically, you have to download Michel Sanner's MSMS program by following these steps:
  • Go to http://mgltools.scripps.edu/downloads
  • Scroll down to 'MSMS X.Y.Z - Current release'
  • When using Linux:
  • Download the file msms_i86Linux2_2.6.1.tar.gz to the yasara/sms directory.
  • Untar the file using tar -xvzf msms_i86Linux2_2.6.1.tar.gz
  • When using MacOSX:
  • Download the file msms_MacOSX_2.6.1.tar.gz to the YASARA.app/yasara/sms directory.
  • Open a terminal, cd to the above directory and untar using tar -xvzf msms_MacOSX_2.6.1.tar.gz
  • When using Windows:
  • Download the file msms_win32_2.6.1.zip to the yasara/sms directory.
  • Unzip the file using any tool like WinZIP
  • Most likely this created a new subfolder. Enter this folder and move the file msms.exe one directory up, so that its final path is yasara\sms\msms.exe
  • Finally, restart YASARA.

When using MSMS, keep in mind that the program returns only one surface per object . If your object contains two molecules that are separate in space, only one of the molecules will get a surface. In such a case, split the object. Cavities are normally also not considered. To be sure, you can calculate surface areas using both, Gaussian and analytic surfaces. If the analytic surface area is significantly smaller, it is most likely incomplete.

Example 1:
SurfPar

Display current surface parameters.


Example 2:
SurfPar Probe=1.5

Set water probe radius to 1.5 A, affecting molecular and solvent accessible surfaces.


Example 3:
SurfPar Resolution=1

Display surfaces with a very high resolution, requiring lots of polygons.


Example 4:
SurfPar Resolution=5

Display surfaces with a very low resolution, requiring only few polygons.


Example 5:
SurfPar Molecular=Numeric

Display molecular surfaces using YASARA's fast numeric algorithm.


Example 6:
SurfPar Molecular=Gaussian

Display molecular surfaces using an even faster fast Gaussian approximation.


Example 7:
SurfPar Molecular=AnalyticDraft

Display molecular surfaces using Michel Sanner's MSMS program, with approximate colors.


Example 8:
SurfPar Molecular=Analytic

As above, but interpolate colors more accurately.


Example 9:
SurfPar ESPMax=50

When coloring a surface by electrostatic potential, the color range red-white-blue is mapped to energies from -50 to 50 energy units calculated for a unit charge on the surface.


Example 10:
SurfPar SmoothCut=Yes

Cut surfaces smoothly when displaying partial surfaces. This will lead to little holes at points where three surface fragments join.


Example 11:
SurfPar SmoothCut=No

Cut surfaces in a rough way, which will not give holes at points where three surface fragments join.


Example 12:
SurfPar Radii=VdW

Use the normal VdW radii when calculating molecular and solvent accessible surfaces.


Example 13:
SurfPar Radii=Solvation

Use realistic effective solvation radii that consider hydrogen bonding when calculating molecular and solvent accessible surfaces.



Example macro:

# EXAMPLE SurfPar
Clear
LightSource Ambience=0,Shadow=0
Console Off
Fog 80
# Build 100 atoms, move them to the back and create a random rotation axis
for i=1 to 100
  BuildAtom C
  JoinObj !1,1,Center=No
  PosAtom (i),Z=20
  for j=1 to 3
    axis(i)(j) = rnd 1-0.5
  speed(i) = rnd 1+1
# Create a molecular surface, colored by atoms, then hide them
ColorAtom all,blue,cyan
ShowSurf Molecular,OutCol=AtomCol,InCol=AtomCol
Hide
AutoRotate Y=1
# Alternately show true molecular surface and Gaussian approximation
LabelPar Font=Arial
typelist='Numeric','True molecular surface',
         'Gaussian','Gaussian approximation to molecular surface'
while 1
  for i=1 to 2
    Unlabel
    Label (typelist(i*2)),Height=0.4,Color=Yellow,Y=-3.5
    SurfPar Resolution=3,Molecular=(typelist(i*2-1))
    # Rotate the atoms 
    for j=1 to 200
      for k=1 to Atoms
        RotAxisAtom (k),0,0,0,(axis(k)1),(axis(k)2),(axis(k)3),(speed(k))
      Wait 1
      # Remove these lines to continue forever
      if j==180
        break 3

Figure: Result of the example macro above.