Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

StyleWin

-

Style Windows


CommandArgument DatatypeDefaultMinMax
Format:StyleWin Type = CurrentOS | Linux | MacOSX | Win2000 | WinXP | WinVistaSTRING---
Python:StyleWin(Type)
Menu:Window > Style
Related:StyleWin, WinTexture , WinFont
Required:


The StyleWin command adapts the look of YASARA's window manager to match the chosen operating system. Since some styles depend on the graphics toolkit of the underlying operating system, they can only be activated there. E.g. the MacOSX style can only be activated in YASARA for MacOSX.

The command also sets the fonts and window animation corresponding to the chosen style, which can however still be fine-tuned afterwards.

Example 1:
StyleWin CurrentOS

Style the windows to match the current operating system.


Example 2:
StyleWin Linux

Adapt YASARA to the look of a typical Linux system.


Example 3:
StyleWin Win2000

Adapt YASARA to the look of Windows 2000.


Example 4:
StyleWin WinXP

Adapt YASARA to the look of Windows XP.


Example 5:
StyleWin WinVista

Adapt YASARA to the look of Windows Vista.