Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Style

-

Set general display style


CommandArgument DatatypeDefaultMinMax
Format:StyleBackbone = Ball | BallStick | Stick | Tube | Ribbon | Cartoon,STRING-- -
   Sidechain = Ball | BallStick | Stick | OffSTRING---
Python:Style(backbone,sidechain)
Menu: View > Scene style
Keys:<F1>  -  Show scene as space filling balls
<F2>  -  Show scene as balls&sticks
<F3>  -  Show scene as sticks
<F4>  -  Show scene as CA-trace
<F5>  -  Show scene as tube, hide side-chain atoms
<F6>  -  Show scene as ribbon, hide side-chain atoms
<F7>  -  Show scene as cartoon, hide side-chain atoms
<F8>  -  Cycle through side-chain styles
Related:Ball, BallStick, Stick , ShowSecStr, HideSecStr , Color
Required:


The Style command sets the overall display style for the scene.

The default style for the backbone is the current style. The default style for the side-chains is the one chosen for the backbone except if Tube, Ribbon or Cartoon are selected, then the default side-chain style is 'off'. The Style command changes the entire scene at once and affects the style of newly loaded 'unstyled' molecules (from PDB files etc.).

Tubes, ribbons and cartoons bridge gaps in the peptide chain provided that the conditions described here are met.

Note that YASARA does not reassign secondary structure at every step of a simulation, as this would slow things down considerably. Instead, press one of the function keys <F5> to <F7> to track changes in secondary structure. Alternatively, you can run a little macro:


Console Off
while 1
  Style Ribbon
  Wait 10


Example 1:
Style Ball

Show scene as space filling balls.


Example 2:
Style BallStick

Show scene as balls&sticks.


Example 3:
Style Stick

Show scene as sticks.


Example 4:
Style Trace

Show scene as CA-trace.


Example 5:
Style Tube

Show scene as tube, hide side-chain atoms.


Example 6:
Style Ribbon

Show scene as ribbon, hide side-chain atoms.


Example 7:
Style Cartoon

Show scene as cartoon, hide side-chain atoms.


Example 8:
Style Backbone=Ball,Sidechain=Stick

Show backbone as balls, side-chains as sticks.


Example 9:
Style Ribbon,Stick

Show backbone as ribbon, side-chains as sticks.



Example macro 1:

# EXAMPLE Style Tube
Clear
LoadPDB 1crn
PosObj 1crn,Z=20
Style Tube

Figure: Result of the example macro 1 above.



Example macro 2:

# EXAMPLE Style Ribbon
Clear
LoadPDB 1crn
PosObj 1crn,Z=20
Style Ribbon

Figure: Result of the example macro 2 above.



Example macro 3:

# EXAMPLE Style Cartoon
Clear
LoadPDB 1crn
PosObj 1crn,Z=20
Style Cartoon

Figure: Result of the example macro 3 above.