Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Setting the parameters

In addition to the straightforward way of solving a structure , you can adapt the protocol at every step to your particular needs.

Before any work can be done, you need to set the default parameters, which is handled by the macro 'nmr_setdefaults'.

Obvious choices are:
  • The filenames for sequence, restraints, structure ensemble and analysis results.
  • The number of structures you want in the ensemble.

Not so obvious choices are:
  • The pH at which the NMR spectrum was recorded: this information will be used in the final explicit solvent refinement step to assign protonation states of amino acid side-chains.
  • The restraining function: YASARA supports the same functions as XPLOR, described in detail here, the usual default is the 'SoftSquare' function.
  • The restraining parameters: These globally affect all restraints and define the distance averaging as well as the overall scaling factors. Scaling factors are usually larger than the XPLOR equivalents due to internal force calculation differences. YASARA uses two different parameter sets: 'defaultpar' for the final refinement stage and analysis, and 'strongpar' for crude refinement with stronger forces.
  • The option to correct cis-peptide bonds before prolines: Contrary to the other 19 amino acids, prolines have a reasonable chance of allowing a preceding cis-peptide bond. If the 'correctcispro' flag is set to 'yes', these cis-peptide bonds will always be corrected, and any cis-peptide bonds that really occur in the structure will thus be missed. It is therefore a good idea to also generate an ensemble with this flag set to 'no', and check if the lowest energy members all share a certain cis-proline.
  • The list of cysteines that are bridged: If you already know which pairs of cysteines are bridged, store their numbers in 'cysbridgelist'. Alternatively, set 'cysbridgelist' to 'Auto' and let YASARA automatically link cysteines close in space.