Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

StopPlugin

-

Stop running plugin


CommandArgument DatatypeDefaultMinMax
Format:StopPlugin ---
Python:StopPlugin()
Menu: This command is mainly useful for macros. There is no menu entry.
Related:RunPlugin
Required:


This command closes the pipe to a running plugin. The plugin will crash with a 'Broken pipe' error as soon as it prints to stdout or runs a YASARA command (using yasara.CommandName).

If the plugin does not create output and hangs in an infinite loop, the StopPlugin command may freeze YASARA for Linux with some of the later kernels. In this case kill the Python task manually to bring YASARA back to life.

The StopPlugin command is executed automatically at the end of the plugin.

Example:
StopPlugin

Terminate the currently running plugin.