Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

StereoPar

-

Set stereo parameters


CommandArgument DatatypeDefaultMinMax
Format:StereoPar EyeDis = Eye distance in pixels,INT- 0 200
   ProTru = Amount of protrusion INT-075
Python: StereoPar(eyedis,protru)
Menu:Window > Stereo > Parameters
Related:Stereo
Required:


Example 1:
StereoPar EyeDis=100, ProTru=0

Show stereo with an eye distance of 100 pixels and no protrusion, objects stay inside the screen.


Example 2:
StereoPar ProTru=75

Let objects maximally protrude from the screen.