Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Stereo

-

Set stereo mode


CommandArgument DatatypeDefaultMinMax
Format:StereoMode = Off | Swap | QuadBuff | DTISTRING ---
Python: Stereo(mode)
Menu:Window > Stereo
Keys:<L>  -  Swap left and right image
Related:StereoPar, FullScreen
Required:


The Stereo command activates the stereographic display of the scene. This requires a graphics card that supports true OpenGL stereo. Since nVIDIA and ATI consider stereo a professional feature, it is normally only enabled in the more expensive Quadro and FireGL cards.

Unless you own a special stereo screen like the DTI from Dimension Technologies, you additionally need appropriate shutter glasses and a CRT screen, since TFT flat screens are normally not fast enough for stereo display.

Example 1:
Stereo Off

Disable stereo mode.


Example 2:
Stereo Swap

Swap left and right image.


Example 3:
Stereo QuadBuff

Use OpenGL quad buffered stereo for shutter glasses.


Example 4:
Stereo DTI

Use special stereo mode for Dimension Technologies 3D LCD Displays.