Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Split<Obj|All>

-

Split objects at split points


CommandArgumentDatatypeDefault Min Max
Format: Split<Obj|All> Object selection,SELECTION ---
   Center = Yes | NoSTRINGYes - -
Python: resultlist = Split<Obj|All>(selection1,center=None)
Menu: Edit > Split > Object
Related: JoinObj , SplitAtom
Required:


The Split command splits the selected objects at 'split points' in the structure. Split points correspond to TER entries in a PDB file, they can be added with SplitMol, SplitRes or SplitAtom and removed with JoinMol, JoinRes or JoinAtom . Split points show up as a single vertical line in the sequence selector at the bottom. The concept is similar to WHAT IF's Cut and Paste, but called differently because Cut and Paste are functions associated with the clipboard.

If the Center flag is set, the new objects are shifted so that mean atom positions coincide with the origins of their local coordinate systems. This makes sure that rotations with the mouse feel natural. When exporting an object, these transformations can be undone by checking the 'Transform' button.

Example 1:
SplitObj 5tim

Split object 5tim into multiple objects, each containing one fragment (usally a molecule), and center the new objects.


Example 2:
SplitObj 3,No

Split object 3 into multiple objects, but do not center the new objects. Atom coordinates will remain unchanged.


Example 3:
objlist() = SplitObj 1c9b

Split object 1c9b into multiple objects and assign the numbers of the created objects to 'objlist'.