Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Split<Atom|Res|Mol>

-

Introduce split points


CommandArgument DatatypeDefaultMinMax
Format:Split<Atom|Res|Mol> Selection SELECTION- - -
Python: Split<Atom|Res|Mol>(selection1)
Menu:Edit > Split
Related: SplitObj , JoinObj, JoinAtom
Required:


A subsequent call to SplitObj will split the object at all split points. Split points show up as a single vertical line in the sequence selector at the bottom and as TER entries in PDB files. The concept is similar to WHAT IF's Cut and Paste, but called differently because Cut and Paste are functions associated with the clipboard.

Example 1:
SplitMol A

Add split points before all molecules named A.


Example 2:
SplitRes 400

Add split points before all residues numbered 400.


Example 3:
SplitAtom 1345

Add a split point before atom 1345.