Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SpeedUp

-

Speed up movements when graphics are slow


CommandArgument DatatypeDefaultMinMax
Format:SpeedUpStatus = On | Off STRINGOn--
Python:SpeedUp(status=None)
Menu:This command is mainly useful for macros. There is no menu entry.
Related:PlayMacro, FramesPerSec
Required:


When displaying large objects with thousands of atoms, the time required to redraw the screen becomes significant and drops below the refresh rate of the display or the requested value. By default, YASARA then increases the steps of movements and rotations so that the effective speed stays the same, and just the number of screen updates decreases. This approach is only possible when either no macro is running or the macro issues a long Wait command. When the macro uses a combination of short (Wait 1) and long Waits, it is recommended to turn off the SpeedUp to avoid unsteady motions.

The SpeedUp setting is automatically changed to the default setting 'On' when a macro stops.

Example 1:
SpeedUp Off

Do not speed up movements and rotations when showing large objects that slow down the graphics.


Example 2:
SpeedUp On

Move and rotate in larger steps when graphics are slow.