Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Span<Atom|Res|Obj>

-

Determine first and last unit spanning a selection


CommandArgument DatatypeDefaultMinMax
Format:Span<Atom|Res|Obj>Selection SELECTION---
Python:resultlist = Span<Atom|Res|Obj>(selection1)
Menu:This command is mainly useful for macros. There is no menu entry.
Related:List, Count
Required:


The Span command returns the numbers of the first and last unit spanning the selection.

Since the 'Span' command always returns numbers, the SpanRes command will fail if the first or last residue in the selection does not have a single number but also contains an insertion code. Also the SpanRes command will create ambiguous results if a residue number exists more than once in the soup. Use 'SpanAtom' instead and look here for more details .

Example 1:
first,last = SpanAtom Obj 1crn

Assign the numbers of the first and last atom in object 1crn to variables 'first' and 'last'.


Example 2:
first,last = SpanAtom Res Lys 40 Mol B

Assign the numbers of the first and last atom in residue Lys 40 in molecule B to variables 'first' and 'last'.


Example 3:
first,last = SpanRes Obj 1

Assign the numbers of the first and last residue in object 1 to variables 'first' and 'last'.


Example 4:
first,last = SpanObj 1crn

Assign the numbers of the first and last object that is named 1crn to variables 'first' and 'last'.