Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SpaceballPar

-

Set Spaceball parameters


CommandArgument DatatypeDefaultMinMax
Format:SpaceballPar Mode = Horizontal | Vertical,STRING ---
   MoveScale = Scaling factor for movements,FLOAT---
  RotateScale = Scaling factor for rotations FLOAT---
Python:SpaceballPar(mode,movescale,rotatescale)
Menu:Options > Input devices > Parameters
Related:SpaceballButton
Required:


Example 1:
SpaceballPar Mode=Horizontal

Assume that the Spaceball is placed horizontally. Lifting the ball will move the object upwards (positive Y direction). That is the standard behavior.


Example 2:
SpaceballPar Mode=Vertical

Assume that the Spaceball is placed vertically. Lifting the ball will move the object closer (negative Z-direction). For some people, this may be more convenient, as it matches the mouse movements.


Example 3:
SpaceballPar MoveScale=0.2

Scale all movements with 0.2, i.e. let objects move more slowly.


Example 4:
SpaceballPar RotateScale=2

Scale all rotations with 2, i.e. let objects rotate quicker.