Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SpaceballButton

-

Assign command to Spaceball button


CommandArgumentDatatypeDefault Min Max
Format: SpaceballButton Number = Button number,INT- 1 15
   Command = YASARA command to run STRING- - -
Python: SpaceballButton(number,command)
Menu:Options > Input devices > Set button
Related:SpaceballPar
Required:


You can also modify the commands directly in yasara.ini (while YASARA is not running). To determine the button numbers, just press the button and look at the message you get.

One or more of the Spaceball buttons may be reserved by the 3DConnexion control panel. You can free them by selecting the button in the control panel, and typing *:ENABLE in the field named 'Mapping code'.

Example 1:
SpaceballButton 12,GrabPrev

Assign the command 'GrabPrev' to the left main button (number 12).


Example 2:
SpaceballButton 9,GrabNext

Assign the command 'GrabNext' to the right main button (number 9).


Example 3:
SpaceballButton 1,"PosAll X=0,Y=0,Z=100"

Center the scene when button 1 is clicked (very useful if you moved it far off screen).


Example 4:
SpaceballButton 5

Print the command currently assigned to button 5.