Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SolvEnergy

-

Calculate solvation energy


CommandArgument DatatypeDefaultMinMax
Format:SolvEnergy Method = BoundaryFast, STRING- - -
   eSolute = Dielectric constant of the solute in e0,FLOAT1.0- -
   eSolvent = Dielectric constant of the solvent in e0 FLOAT80.0--
Python:resultlist = SolvEnergy(method,esolute=None,esolvent=None)
Menu:Analyze > Energy > Solvation
Related:EnergyUnit, Energy , BindEnergy
Required:


The SolvEnergy command calculates the interaction energy between the solvent and the solute. This is done by treating the solvent as a continuum without explicit solvent molecules.

The 'solute' consists of all the atoms in the simulation cell and thus includes all water molecules that are present. The usual approach is therefore to delete all explicit solvent molecules before running the SolvEnergy command.

Results are returned in units of either kJ/mol or kcal/mol, depending on the current EnergyUnit.

The Method parameter will allow to choose among methods with different accuracy/performance trade-offs in the future. Currently only a very fast first-order boundary element approximation to the solvation energy is supported.

BoundaryFast: This method performs the following steps:

  • Build a molecular surface around the solute atoms.
  • Calculate the electrostatic field generated by the point charges of the solute atoms at all surface vertices.
  • Calculate the induced charges at all surface vertices, which are proportional to the scalar product of the electrostatic field vectors and the surface normals.
  • Normalize the induced charges according to this formula:

TotalInducedCharge = SumOverSoluteCharges*(eSolute-eSolvent)/(eSolute+eSolvent)

where eSolute and eSolvent are the dielectric constants passed to the SolvEnergy command.

  • To avoid numerical instabilities when SumOverSoluteCharges approaches zero, the previous three steps are performed separately for all positive charges and all negative charges.

  • Finally, calculate the electrostatic interaction energy between the induced charges and the solute charges.

As a side-effect, the command calculates the molecular surface area which is returned as the second value. This surface area can then be used to estimate the non-electrostatic components of the solvation energy: the Van der Waals interaction energy between solvent and solute, and (for free energy calculations) the energy of cavity formation. Note that the solvent accessible surface area is often better suited for these calculations, e.g. a common empirical formula (from 'Computational Medicinal Chemistry for Drug Discovery', page 271) is:

NonElectrostaticSolvEnergy [kcal/mol] = 0.85 + 0.005 * SolventAccessibleSurfaceArea [A^2, probe radius 1.4 A]

Since the 'BoundaryFast' method has been calibrated to reproduce solvation energies obtained with slower methods, it critically depends on (and thus enforces) certain surface parameters (e.g. numeric molecular surface, probe radius 1.4 A, solvation radii).

Example 1:
SolvEnergy

Calculate the solvation energy for the atoms in the cell using a dielectric constant of 1 for the solute and 80 for the solvent.


Example 2:
energy,surfarea = SolvEnergy 

As above, and assign the result to variable 'energy'. In addition, the molecular surface area is assigned to 'surfarea'.


Example 3:
SolvEnergy eSolute=4,eSolvent=50

Calculate the solvation energy for a solute with dielectric constant 4 in a solvent with dielectric constant 50.