Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SolvDensity

-

Get solvent density in simulation cell


CommandArgumentDatatypeDefault Min Max
Format: SolvDensity Name = Solvent residue nameSTRINGHOH - -
Python: result = SolvDensity(name=None)
Menu:Analyze > Solvent density
Related: PressureCtrl , FillCellWater, FillCellObj
Required:


The SolvDensity command measures the density of solvent molecules with the given name in the simulation cell. This is done with the following recipe:

  • Divide the cell into little cubes.
  • Remove cubes that contain non-solvent atoms.
  • Remove cubes that are neighbors of cubes with non-solvent atoms.
  • Remove cubes that are close to the wall of non-periodic cells.
  • For the remaining cubes, sum up the mass of the solvent atoms inside and divide by the summed up cube volume.

As the number of solvent molecules in these cubes is not constant during a simulation, the actual density fluctuates and only the time-average is used by the PressureCtrl command to rescale the simulation cell.

This command requires that the soup has been cleaned up for simulation .

Example 1:
SolvDensity

Measure water density inside the simulation cell.


Example 2:
dens = SolvDensity DMS

Assign the density of dimethyl sulfoxide to variable 'dens'.