Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Something is wrong with your molecule

Molecules may be small, but they are not simple. Consequently, a lot of things can go wrong with atom names, bond orders, chemical elements etc.

° 

You used OpenBabel ('other Fileformat') to read/write the molecule

To support the millions of fileformats out there, YASARA uses OpenBabel, a library available from http://openbabel.sourceforge.net . OpenBabel has mainly one weak spot, and that's residue names and numbers. Many of the supported file formats do not even know the concept of 'residues' because they come from quantum chemistry, where one usually works with just one molecule. So after loading a structure with OpenBabel, click on various residues and check that the names and numbers are correct. Otherwise try to export the structure in PDB format before loading it in YASARA.