Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Something is wrong with the user interface

When you click on an entry in the top menu line or bring up a context menu, some things can go wrong.

° 

YASARA crashes completely when you activate a menu

This behaviour was confirmed for two graphics chips:

  • NVIDIA Riva TNT2 with very old, broken OpenGL drivers (e.g. version .1200). Download the latest drivers from www.nvidia.com to solve this problem. Version .5216 was confirmed to work perfectly.

  • S3 Twister chips that are sometimes found in notebooks: Crashes were observed with rather old, broken OpenGL drivers. Get the latest one and notify us if this solves the problem.

° 

It takes too long till the menu appears

A trivial first solution is to disable window animations: click on Window > Animation > Off.

Then make sure that you have hardware accelerated OpenGL support installed .

If you are using old drivers for ATI Radeon and Matrox G400-G550 cards, it may take half a second for the menu to appear. Owners of a Radeon 8500 card and above can simply update the driver, this will solve the problem. For cards older than the Radeon 8500, this may help as well, please report your experience. For Matrox owners, updating the driver can even make things worse, and it's probably best to just get a new graphics card.

° 

When the menu appears, the colors turn crazy

This only happens with Radeon 8500 cards and is a bug in ATI's driver. The problem has been reported, and solved by ATI in the Catalyst driver 3.4 and later. As a work-around, you can also go to Control panel > Display > Settings and set the screen color depth to '32 bit true color'. You can also try to edit yasara.ini and set VisualQual to 0.

° 

Some menu entries are missing

YASARA uses plugins written in Python, that add their own menu entries. If Python is not installed or broken, these menu entries will not appear. Look here for more details .

° 

The mouse pointer disappears or flickers

This can happen if you installed a 'fancy mouse pointer'-tool, that shows very colorful pointers. If these pointers cannot be displayed as a hardware cursor by your graphics card, the operating system has to copy the mouse pointer pixel by pixel into the video ram, which often does not work with OpenGL windows. Switch back to a simple mouse pointer to solve this issue. (Under Linux, that's often an option in /etc/X11/XF86Config or /etc/X11/xorg.conf, e.g. for NVIDIA cards, you must set hwcursor to "1").

° 

Some keys do not work as expected

The usual reason is that another application has registered certain keyboard-shortcuts as hot-keys, which then do not reach YASARA anymore. Exit YASARA and press the problematic key or combination of keys to see what happens and find the application in charge. Then change the hot-key settings there.

° 

The Spaceball 3D controller does not work as expected

The Spaceball from 3DConnexion is currently only supported in Linux. YASARA has been tested with the Spaceball 3003FLX, but also the later models should be compatible.

Before you start YASARA, make sure that the Spaceball driver is running:

ps -ef | grep xdriver

If you do not see output except one line with grep, start the xdriver manually (you can find the program on the Spaceball CD in the unix/linux directory).

./xdriver -new

Click 'Automatic search' to locate the Spaceball. If it cannot be found, follow the hints displayed and also run the xdriver program as root.

As soon as the Spaceball has been detected, choose the Application 'X Window Driver 2.0/3.0' and click 'Install', then 'Exit'.

Now you can start YASARA and configure your Spaceball by clicking on Window > Spaceball. More details can be found at the SpaceballPar and SpaceballButton commands.