Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Simulation snapshots - Load and save simulation states

Load simulation snapshots to restore atom positions and velocities at a certain time or save them in periodic time intervals. Atom positions without velocities can also be saved and restored in XTC format, which minimizes the required storage space.

° 

LoadSim

-

Load simulation snapshot in sim format

° 

LoadXTC<Obj|All>

-

Load simulation snapshot in XTC format

° 

SaveSim

-

Save simulation snapshots in sim format

° 

SaveXTC

-

Save simulation snapshots in XTC format