Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SimSteps

-

Set number of simulation steps per screen update


CommandArgument DatatypeDefaultMinMax
Format:SimStepsNumber = Number of simulation steps per screen update INT ---
Python:SimSteps(number)
Menu:Simulation > Timestep
Related:Timestep
Required:


Updating the screen takes a certain amount of time which can become the rate limiting step when simulating small molecules. Choosing a SimSteps value >1 lets YASARA respond more slowly, but increases the overall simulation performance. SimSteps is mainly used in self-running macros that do not require user interaction.

Example 1:
SimSteps 5

Update the screen only every 5th simulation step.


Example 2:
SimSteps 1

Show every single simulation step.