Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SimSpeed

-

Set simulation speed


CommandArgument DatatypeDefaultMinMax
Format:SimSpeed Type = Normal | Fast STRING- - -
Python: SimSpeed(Type)
Menu:Simulation > Force field
Related: Longrange , Interactions, Cutoff , ForceField, ScaleForce
Required:


The SimSpeed command sets the speed/accuracy trade-off for the simulation algorithms. Currently it affects the treatment of longrange electrostatics and the force switching function near the cutoff in (Y)AMBER force fields.

If Longrange electrostatics are activated, the SimSpeed command adjusts the Particle Mesh Ewald (PME) parameters. The main determinants for the PME accuracy are the grid spacing, the tolerance for the direct space sum, and the spline interpolation order. With 'SimSpeed Normal', the tolerance is 1e-5 and the splines are of 6th order. With 'SimSpeed Fast', the tolerance is 1e-4 and the splines are of 4th order. The grid spacing cannot be adjusted and is always <1 A.

If Longrange electrostatics are not activated, the SimSpeed setting affects the treatment of forces near the cutoff distance. With 'SimSpeed Fast' the forces are simply truncated. With 'SimSpeed Normal', a switching function is applied so that the forces smoothly converge to zero at the cutoff distance.

Example 1:
SimSpeed Normal

Choose a normal simulation speed. If PME is activated (Longrange), the tolerance for the direct space sum is 1e-5, and the grid interpolation is done with 6th order splines.


Example 2:
SimSpeed Fast

Choose a fast simulation speed, treating long range electrostatics with reduced accuracy.