Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Sim

-

Control simulation


CommandArgument DatatypeDefaultMinMax
Format:SimControl = Init | On | Pause | Continue | Off,STRING ---
   in = femtoseconds till pauseINT-- -
Python:Sim(control,In)
Menu:Simulation > Simulator
Keys:<F11>  -  Pause/continue simulation, click here for MacOSX alternatives.
<F12>  -  Start/stop simulation, click here for MacOSX alternatives.
<Pause> or <P>  -  Pause/continue all tasks, including the simulation
Related:SaveSim, LoadSim
Required:


The Sim command controls YASARA's simulation state.

  • Sim On transfers all active objects into the common coordinate system of the simulation cell and starts the simulation with the current parameters. During a simulation, you cannot move objects around independently, and any severe changes to the soup (like deleting atoms) or the force field parameters automatically stop the simulation. Look at the macro mcr/md_run.mcr for usage examples.

  • Sim Off stops a simulation and creates a new local coordinate system for every object, so that it can be moved and rotated independently.

There are two options to run a simulation for a certain time :
  • Use Wait in a macro to wait for a given number of simulation steps.
  • Use Sim Pause,in=... to pause the simulation some (simulation) time later.

If you want to run a simulation without graphics , start YASARA with the -con or -txt command line parameter to activate the console. This also helps if your simulation must be 100% reproducible: at the beginning of the simulation, the atoms are transformed from their local coordinate systems to the coordinate system of the simulation cell. A different orientation (e.g. after a rotation with the mouse) will lead to numerical noise in the transformation matrix, some of the lowest bits of the transformed atom coordinates will flip, and the MD trajectory will be different.

Example 1:
Sim Init

Initialize force field parameters.


Example 2:
Sim On

Start simulation.


Example 3:
Sim Pause

Pause simulation.


Example 4:
Sim Pause,in=100000

Pause simulation in 100 picoseconds.


Example 5:
Sim Continue

Continue simulation after pausing.


Example 6:
Sim Off

Stop simulation.