Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ShowTrace

-

Show trace through atoms


CommandArgument DatatypeDefaultMinMax
Format:ShowTrace Atom selectionSELECTION - --
Python:ShowTrace(selection1)
Menu:View > Show atom trace
Related: HideTrace
Required:


The ShowTrace command sequentially connects the selected atoms with a trace, the most prominent example being a trace of Calpha carbons.

A trace is automatically interrupted at molecule boundaries or if two atoms are not connected via one or more covalent bonds. To prevent the trace from bridging gaps in a peptide chain, one thus needs to delete the unusually long peptide bonds: DelBond all,all,LenMin= 3

It is still possible to change the style of the traced atoms (Ball,BallStick ,Stick) and often helpful to hide non-traced atoms.

Example 1:
ShowTrace CA Obj 1

Show a CA-trace for object 1.


Example 2:
ShowTrace CA Protein

Show a CA-trace for all proteins.


Example 3:
ShowTrace C1* NucAcid

Show a trace through the C1* carbons in all nucleic acids.



Example macro:

# EXAMPLE ShowTrace
Clear
LoadPDB 5tim
# Easier alternative: Style Trace, StickAll
Style Stick
StickRadius 100
BallRadius 60
HideAtom !CA
ShowTraceAtom CA
ColorAtom CA,Blue,Cyan
PosObj 5tim,Z=70
OriObj 5tim,-80,320,-73

Figure: Result of the example macro above.