Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ShowTorus

-

Show a torus


CommandArgument DatatypeDefaultMinMax
Format:ShowTorus LargeRadius = Radius of the torus ring in Å, FLOAT10.0- -
   LargeEdges = Number of edges around the torus ring, INT 32--
  SmallRadius = Radius of the ring cross-section in Å,FLOAT 1.0 --
  SmallEdges = Number of edges around the ring cross-section,INT12- -
   Color = Torus color,RGBCOLORRed - -
   Alpha = Alpha blending factor FLOAT100.0 0.0 100.0
Python: result = ShowTorus(largeradius=None,largeedges=None,smallradius=None,smalledges=None,color=None,alpha=None)
Menu:Effects > Show solid > Torus
Related:ShowCone, ShowSphere , ShowBox, MoveMesh
Required:


The ShowTorus command creates a ring, horn or spindle torus, depending on the chosen parameters:

  • If LargeRadius is larger than SmallRadius, the result is a normal ring torus, where the total outer radius equals LargeRadius+SmallRadius, while the radius of the inner hole equals LargeRadius-SmallRadius.

  • If LargeRadius equals SmallRadius the inner hole vanishes and the result is a horn torus.

  • If LargeRadius is smaller than SmallRadius the result is weird - a spindle torus.

The LargeEdges and SmallEdges parameters define how many edges will be used to approximate the round shape of the torus. Normally the default values are enough to create a smooth appearance.

The created torus rotates around the origin of its local coordinate system , which is at the center of the torus. Use the MoveMesh command to shift the origin.

Example 1:
ShowTorus LargeRadius=8,LargeEdges=32,SmallRadius=2,SmallEdges=10,Color=Red

Show a red ring torus with an outer radius of 10 (=8+2) A and an inner radius of 6 (=8-2) A.


Example 2:
ShowTorus LargeRadius=8,LargeEdges=32,SmallRadius=8,SmallEdges=10,Color=Red

As a above, but set both radii equal, resulting in a horn torus without a visible hole.



Example macro:

# EXAMPLE ShowTorus
# Requires YASARA Model
Clear
Console Off
# Create one single big spindle torus
radius=50
spindle = ShowTorus LargeRadius=(radius),LargeEdges=32,
                    SmallRadius=(radius+10),SmallEdges=20,Color=Red
x,y,z = PosObj (spindle)
for i=1 to 30
  # Create a small torus
  lr = rnd 5
  obj = ShowTorus LargeRadius=(lr),SmallRadius=(rnd lr),Color=(rnd 'ffffff')
  # Place it on a ring inside the big spindle torus
  alpha = rnd 360
  dis = radius+rnd 32-16
  PosObj (obj),X=(x+dis*cos alpha),Y=(y+dis*sin alpha),Z=(z+rnd 32-16)
  # Let it rotate randomly
  AutoRotateObj (obj),X=(rnd 2),Y=(rnd 2),Z=(rnd 2)
# Choose the view
Rotate X=60
AutoRotate Y=0.5
Move Z=30
Wait 250

Figure: Result of the example macro above.