Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ShowTab

-

Show table data as 3D object


CommandArgumentDatatypeDefault Min Max
Format: ShowTab Table selection,SELECTION ---
   Width = Width per table cell in Å,FLOAT1.0--
  Range = Total height of 1D/2D object or invisible range of 3D object,FLOAT 10.0--
   Min = Minimum table value, FLOATMin - -
   MinCol = Color of minimum value, RGBCOLORblue - -
   Max = Maximum table value, FLOATMax - -
   MaxCol = Color of maximum value, RGBCOLORyellow - -
   Style = Visualization style for 3D tables: Points | Crosses | Planes STRINGPoints --
Python:resultlist = ShowTab(selection1,width=None,Range=None,Min=None,mincol=None,Max=None,maxcol=None,style=None)
Menu:Options > Table > Show
Related: Tab , Tabulate, DelTab , SelectTab, MakeTab , LoadTab, SaveTab , FlipTab, PointPar
Required:


The graphical representation created by ShowTab depends on the dimensionality of the table.

  • For one-dimensional tables, it is a simple curve showing the table colums along the X-axis and the table cell values along the Z-axis. The Range parameter determines the height of the curve.

  • For two-dimensional tables, it is a height map showing the table columns and rows along the X- and Y-axes, and the table cell values along the Z-axis. The Range parameter determines the height of the map.

  • For three-dimensional tables, it is a three-dimensional object showing the table columns, rows and pages along the X-, Y- and Z-axes, and the table cell values only by color code. The Style parameter chooses either a box of 'Points', 'Crosses' or independent 'Planes'. The Range parameter determines the invisible table cell percentage, e.g. if set to 30, all table cells with values smaller than 30% of the maximum value remain invisible.

The Min and Max parameters can be used to clip the table cell values to a certain range. If left out, the true minimum and maximum values are used.

Example 1:
ShowTab MyTable,Width=1,Range=20

Create a graphical representation of the values in 'MyTable', each table cell corresponds to a 1 A^2 area, the total height is 20 Angstrom for one- and two-dimensional tables.


Example 2:
obj = ShowTab 5,Min=-50,MinCol=green,Max=75,MaxCol=red

Create a graphical representation of the values in table 5, clipped to the interval [-50,75], where -50 is colored green and 75 is colored red. Assign the number of the graphics object to variable 'obj'.



Example macro:

# EXAMPLE ShowTab
# Requires YASARA Model
Clear
Console Off
len=16
cellwidth=1.0
height=(len*2)
# Create a growing 3D table
MakeTab Density3D,Dimensions=3,Columns=(len*2+1),Rows=(len*2+1)
# Fill it with a simple function
for z=-len to len
  for y=-len to len
    for x=-len to len
      Tabulate (len*len-x*x-y*y-z*z)
# Show various 3D styles
for style in 'Points','Crosses','Planes'
  ShowTab Density3D,Width=(cellwidth),Range=10,Min=0,MinCol=Blue,
          Max=(len*len),MaxCol=Yellow,Style=(style)
# Extract a 2D page
MakeTab Density2D,Dimensions=2,Columns=(len*2+1)
Tabulate Tab Density3D,Page=(len+1)
ShowTab Density2D,Width=(cellwidth),Range=(height),Min=0,MinCol=800000,
        Max=(len*len),MaxCol=Yellow
# Extract a 1D row
MakeTab Density1D,Dimensions=1
Tabulate Tab Density2D,Row=(len+1)
ShowTab Density1D,Width=(cellwidth),Range=(height),Min=0,MinCol=008000,
        Max=(len*len),MaxCol=Yellow
# Position the objects
poslist='X=(1.5*len),Y=(len)','X=0,Y=(2.2*len)','X=(-1.5*len),Y=(len)',
        'X=(1.5*len),Y=(-2*len)','X=(-1.5*len),Y=(-2*len)'
for i=1 to 5
  PosObj (i),(poslist(i)),Z=100
AutoRotateObj 1,X=1
AutoRotateObj 2,X=-0.25,Y=-0.25
AutoRotateObj 3,Y=1
RotateObj 4-5,X=-90
Console On

Figure: Result of the example macro above.