Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ShowSurf<Atom|Res|Mol|Obj|All>

-

Show surface


CommandArgument DatatypeDefaultMinMax
Format:ShowSurf<Atom|Res|Mol|Obj|All> Selection, SELECTION- - -
   Type = VdW | Molecular | Accessible | All,STRINGAll - -
   Update = Dynamic | Static,STRING Dynamic--
   OutCol = Color used for outside of surface object,RGBCOLORDefault - -
   OutAlpha = alpha blending factor for the outside of surface object, FLOATDefault 0.0100.0
  InCol = Color used for inside of surface object, RGBCOLOROutCol--
  InAlpha = alpha blending factor for the inside of surface object, FLOATOutAlpha 0.0100.0
  Specular = Yes | No | CurrentSTRINGCurrent--
Python:resultlist = ShowSurf<Atom|Res|Mol|Obj|All>(selection1,Type=None,update=None,outcol=None,outalpha=None,incol=None,inalpha=None,specular=None)
Menu:View > Show surface
Related: HideSurf , ColorSurf, MoveMesh , Surf, SurfPar , AddEnv, RemoveEnv
Required:


The ShowSurf command shows the Van der Waals, molecular and/or solvent accessible surfaces of the selected atoms. The difference between these surface types is explained in the help movie 'Surfaces I'. In short:

  • Van der Waals surface: if you think of atoms as spheres with a given Van der Waals radius, then the Van der Waals surface consists of all the points on these spheres that are not inside another sphere. In practice, the Van der Waals surface is of limited use, because it can be found throughout a protein and does not tell much about the interaction with the solvent.

  • Molecular surface: this is the Van der Waals surface from the viewpoint of a solvent (=water) molecule, which is a much more useful concept. The water is assumed to be a sphere of a given radius, also called the 'water probe', that rolls over the solute (e.g. the protein). Those parts of the Van der Waals surface that the water probe can touch are simply copied to the molecular surface (and called the 'contact surface'). Clefts in the Van der Waals surface that are too narrow for the water probe to enter are replaced by the Van der Waals surface of the water probe itself (and called the 'reentrant surface'). So the molecular surface is a smooth composition of two Van der Waals surfaces: the one of the solute and the one of the solvent molecule while it traces the contours of the solute. Other common names for the molecular surface are 'solvent excluded surface' or 'Connolly surface'. The above simplified text book description ignores the fact that the water probe can interact with the solute via hydrogen bonds, thereby getting closer than expected from the Van der Waals radii. YASARA can consider these deviations by using effective solvation radii instead of normal Van der Waals radii. From the computational point of view, this surface is the hardest to calculate. YASARA contains a very fast (multi-threaded) and grid-based algorithm, and an even faster Gaussian approximation. The external MSMS program can also be used.

  • Solvent accessible surface: this surface consists of all the points that the center of the water probe (i.e. the nucleus of the oxygen atom in the water molecule) can reach while rolling over the solute. The shortest possible distance between the water oxygen nucleus and a solute atom is simply the sum of the Van der Waals radii of the solute atom and the water probe. That is why the solvent accessible surface is conceptually similar to the Van der Waals surface, one simply adds the water probe radius to the solute atom's Van der Waals radii before calculating the surface. Again, the above description ignores the fact that the water probe can interact with the solute via hydrogen bonds, thereby getting closer than expected from the Van der Waals radii. YASARA can consider these deviations by using effective solvation radii instead of normal Van der Waals radii.

The Update flag allows to choose between dynamic and static surfaces. Dynamic surfaces are updated permanently, e.g. during a molecular dynamics simulation, while static surfaces are independent objects that can nevertheless still be colored after creation. However, static surface objects lose the connection to the atoms from which they originated, so the two special colors 'AtomCol' and 'ESP' must be selected immediately when creating the surface, not afterwards with ColorSurf.

Several hints for coloring a surface can be found here.

The surface shown is influenced by the atoms in the surface environment, since the ShowSurf command performs the following steps:

  • Combine the selected atoms with those in the surface environment.
  • Construct the total surface.
  • Show the surface portion contributed by the selected atoms.

To display the contribution of residues 20-30 to the total accessible surface of object 1crn, two commands are required:

AddEnvObj 1crn
ShowSurfRes 20-30 Obj 1crn,accessible

YASARA Model+ is required to create static surface objects and to use surface environments.

If no simulation is running, each object has its own local coordinate system, and surfaces are shown independently for each object. During a simulation, all objects share the coordinate system of the simulation cell, they 'feel' each other, and consequently surfaces are drawn for all objects together.

The default colors can be changed with the ColorSurfAll command.

Example 1:
ShowSurfAll All

Show all three surfaces (VdW,molecular,accessible) for all objects using default colors.


Example 2:
ShowSurfObj 1crn,Accessible,OutCol=AtomCol,InCol=Red

Show the solvent accessible surface of object 1crn, colored like the closest atom outside and red inside.


Example 3:
ShowSurfRes 20-30,Molecular,OutCol=Green,70,Blue,90,No

Show a molecular surface for residues 20-30, colored green (30% transparent) from the outside and blue (10% transparent) from the inside, without specular highlights.


Example 4:
ShowSurfMol A,VdW,Update=Static

Create a separate static Van der Waals surface object for molecule A using default colors.


Example 5:
obj = ShowSurfAtom CA,Accessible,Static,Yellow,100,ESP,50

Create another static accessible surface object for all CA atoms, colored yellow from outside and by electrostatic potential (half transparent) on the inside, and assign its number to variable 'obj'.



Example macro:

# EXAMPLE ShowSurf
# Requires YASARA Model
Clear
# Water probe radius 1.4 A, medium resolution, gaussian molecular surfaces
SurfPar Probe=1.4,Resolution=3,Molecular=Gaussian
# Opacity of surface outsides and insides
surfalphaout=100, 50,  0,   20
surfalphain =100, 100, 100, 50
# Surface types and colors 
surftype='VdW','Molecular','Accessible'
surfcol='ff0000','ff8000','ffff00'
# Show 4x3 surfaces
Style Ribbon,Stick
for y=1 to 3
  # Display surface type
  obj=MakeTextObj Name=SurfType,Width=40,Height=3
  Font Times,Height=3,Color=(surfcol(y)),Depth=4.0,DepthCol=303030
  PosText 50%,0%,Center
  Print (surftype(y))
  PosObj (obj),-40,(-(y-2)*20),75
  OriObj (obj),Gamma=90
  for x=1 to 4
    obj=LoadPDB peptide8
    PosObj (obj),(20*(x-2)-5),(-(y-2)*18),75
    # Show and color surface
    ShowSurfObj (obj),(surftype(y)),OutCol=(surfcol(y)),OutAlpha=(surfalphaout(x)),
                InCol=Green,InAlpha=(surfalphain(x))
Style BallStick,Stick
AutoRotateObj peptide8,Y=0.2
HUD Off

Figure: Result of the example macro above.