Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ShowSimGrid

-

Show simulation grid


CommandArgument DatatypeDefaultMinMax
Format:ShowSimGrid Type = Grid type flags,INT- - -
   Center = number of central grid elementINT- - -
Python: result = ShowSimGrid(Type,center)
Menu:This command is mainly useful for macros. There is no menu entry.
Related:Cutoff
Required:


This command is included for education purposes, to explain the use of 3D grids to rapidly find all neighbours for a given atom. The individial types can be combined using a bitwise OR.

Example 1:
ShowSimGrid Type=1

Show the simulation grid elements inside the cell.


Example 2:
ShowSimGrid Type=2

Show the simulation grid elements touching the cell wall.


Example 3:
ShowSimGrid Type=4

Show the simulation grid elements outside the cell.


Example 4:
obj = ShowSimGrid Type=8,Center=100

Show all simulation grid elements interacting with element 100 and assign the number of the created grid object to variable 'obj'.



Example macro:

# EXAMPLE ShowSimGrid
# Requires YASARA Dynamics
Clear
ForceField Amber96
Boundary periodic
LoadPDB 1crn
Clean
Cell X=30,Y=30,Z=30,Alpha=70,Beta=90,Gamma=80
Sim On
ShowSimGrid Type=3
PointPar Radius=0.5,plastic=no
Pos Z=55

Figure: Result of the example macro above.