Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ShowRota<Res|Mol|Obj|All>

-

Show side-chain rotamers


CommandArgument DatatypeDefaultMinMax
Format:ShowRota<Res|Mol|Obj|All> SelectionSELECTION - --
Python:resultlist = ShowRota<Res|Mol|Obj|All>(selection1)
Menu:Analyze > Rotamers of
Related: Check
Required:


This command maps to WHAT IF's DGROTA option. WHAT IF takes the fragment of five residues with the selected residue in the middle and searches the database for equally long fragments with a highly similar backbone conformation. Highly similar typically means that the RMSD on Calpha atoms is lower than 0.7 A.

Then a new object is created, which contains all the possible side-chain conformations of the selected residue, colored from blue (best backbone fit) to yellow (worst backbone fit).

This command ignores the environment, e.g. possible bumps, as well as the two N- and C-terminal residues.

The created objects consist of points and lines that can be styled with the PointPar command. They are not linked to the atoms they originated from, and are thus not clickable. If you want to obtain real rotamers that are part of the soup, then use the SampleDih command.

For each rotamer, a new object is created. As YASARA's limit is 250 objects, that is also the maximum number of residues whose rotamers can be shown at the same time.

Example 1:
ShowRotaRes Tyr 106

Show the backbone-dependent rotamer distribution for residue Tyr 106.


Example 2:
ShowRotaObj 1crn

Show the rotamer distributions for all residues in object 1crn.


Example 3:
rotlist() = ShowRotaMol A

Show the rotamer distributions for all residues in molecule A and assign the numbers of the created objects to the list 'rotlist'.



Example macro:

# EXAMPLE ShowRota
# Requires the Twinset
Clear
# Style 1crn
LoadPDB 1crn
Style Trace
ColorBonds grey
# Show all side-chain rotamers
ShowRota
# Style the side-chain rotamers
PointPar Radius=5,plastic=Yes
# Orient the object
Pos Y=-1,Z=24
Ori 214,29,10

Figure: Result of the example macro above.