Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ShowRest<Atom|Res|Mol|Obj|All>

-

Show restraints


CommandArgument DatatypeDefaultMinMax
Format:ShowRest<Atom|Res|Mol|Obj|All> Selection, SELECTION- - -
   Class = Restraint class name STRINGAll - -
Python: ShowRest<Atom|Res|Mol|Obj|All>(selection1,Class=None)
Menu:Simulation > Show restraints
Related: HideRest , ScaleRest, DelRest , ListRest, LoadTbl , RestrainDis, RestrainDih , RestrainPot, RestrainPar , RestEnergy, RestViol
Required:and the NMR Structure Determination Module


The ShowRest command shows those distance or dihedral angle restraints that involve one of the selected atoms.

The Class parameter allows to select a certain restraint class. In addition to class names specified when loading the restraints , the built-in names 'Violate' and 'Fulfill' select violated and fulfilled restraints respectively.

Example 1:
ShowRestAll

Show all restraints.


Example 2:
ShowRestObj 4

Show restraints in object 4.


Example 3:
ShowRestAll Class=Violate

Show all violated restraints.


Example 4:
ShowRestAtom Element !H

Show those restraints that do not involve hydrogen atoms.