Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ShowMessage

-

Show text message at the bottom


CommandArgumentDatatypeDefault Min Max
Format: ShowMessage Text = Message text to showSTRING ---
Python: ShowMessage(text)
Menu:Effects > Message > Show
Related: HideMessage , ShowButton
Required:


The ShowMessage command displays the specified text message at the bottom of the screen, just above the sequence selector.

This is the method of choice for providing instructions during tutorials. Use HideMessage to remove the message again.

Example:
ShowMessage Hello World!

Show the message "Hello World!" at the bottom of the screen.