Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ShowImage

-

Show images


CommandArgument DatatypeDefaultMinMax
Format:ShowImage Image selection, SELECTION- - -
   X = Top left X-coordinate of shown area in pixels, FLOAT0.0- -
   Y = Top left Y-coordinate of shown area in pixels ,FLOAT0.0--
  Width = Width of shown area in pixels,FLOAT original width --
   Height = Height of shown area in pixels,FLOAToriginal height --
   Alpha = Alpha blending factor in percent,FLOAT100.00.0100.0
  Priority = Image priority 0 (back) or 1 (front) INT 0--
Python:ShowImage(selection1,x=None,y=None,width=None,height=None,alpha=None,priority=None)
Menu:Effects > Image > Show
Related: LoadBMP , LoadPNG, AutoMoveImage , AnimateImage, SwapImage , HideImage, DelImage , MakeImageObj
Required:


Image coordinates originate from the top left image corner (0/0), with the X-axis pointing right and the Y-axis pointing downwards.

Example 1:
ShowImage 1

Show image 1 as the background, fitting it exactly into YASARA's window.


Example 2:
ShowImage 2,X=150,Y=100,Width=400,Height=300,Alpha=50,Priority=1

Fit a 400x300 rectangular area of image 2 (with its top left corner at coordinates 150/100 in image 2) into YASARA's window. Display it on top of the scene, half transparent.


Example 3:
ShowImage 2,X=-200,Y=100,Width=400,Height=300,Alpha=100,Priority=1

Fit a 200(sic!)x300 rectangular area of image 2 (with its top left corner at coordinates 0/100 in image 2) into the right half of YASARA's window. Display it on top of the scene, not transparent except for the color chosen with LoadBMP.



Example macro:

# EXAMPLE ShowImage
# Requires YASARA Model
Clear
LoadPDB 1crn
Style Stick
LoadBMP ysrbkgr1
ShowImage ysrbkgr1

Figure: Result of the example macro above.