Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ShowHBo<Atom|Res|Mol|Obj|All>

-

Show hydrogen bonds


CommandArgument DatatypeDefaultMinMax
Format:ShowHBo<Atom|Res|Mol|Obj|All> Selection, SELECTION- - -
   Extend = Yes | NoSTRING No --
Python:ShowHBo<Atom|Res|Mol|Obj|All>(selection1,extend=None)
Menu:View > Show hydrogen bonds
Related: HideHBo , ColorHBo, ListHBo , AddHyd, OptHyd
Required:


The ShowHBo command flags the selected atoms for showing hydrogen bonds. A hydrogen bonds is only shown if both binding partners have been flagged and a hydrogen atom is bound to the donor.

If the ShowHBo command behaves unexpectedly, consider these points:

  • Hydrogen bonds can only be displayed if the hydrogens forming the bonds are actually present. If you do not want to show the hydrogen atoms, simply hide them with 'HideAtom Element H'.

  • Hydrogen bonds are only shown between flagged atoms. So you must make sure that the ShowHBo command is applied to both, acceptor AND donor atoms. If the Extend flag is set to 'Yes', YASARA will make sure that both are selected by extending the selection to all hydrogen bonding partners.

  • Hydrogen bonds between different objects can only be shown during a simulation, when both objects reside in the same coordinate system. If you do not want to start a simulation, simply join the objects.

  • If hydrogens that can rotate freely (hydroxyl groups or water molecules) are not placed optimally, a hydrogen bond may not be recognized. With YASARA Model, you can manually rotate the hydrogen. With YASARA Dynamics, you can make an energy minimization to let YASARA find the best hydrogen positions, and in the Twinset, there is a specialized command to optimize the hydrogen bonding network.

Hydrogen bonds are displayed as disks. The fewer disks, the shorter the distance and the stronger the bond.

Since hydrogen bonds are updated in real-time when atoms move, it would be too costly to support showing hydrogen bonds between two separate selections. This feature is however supported for listing existing hydrogen bonds, e.g. ListHBoMol A,B lists all hydrogen bonds between molecules A and B. Nevertheless, you can still get very close to also showing these specific hydrogen bonds with the following trick:


# Load PDB file 5TIM, a TIM barrel dimer, and add hydrogens
Clear
LoadPDB 5tim
AddHyd
# Show hydrogen bonds for all atoms at the interface between molecules A and B
# Note that the distance 2.5 A corresponds to YASARA's H-bond cutoff
ShowHBoAtom Mol A with distance<2.5 from Mol B
ShowHBoAtom Mol B with distance<2.5 from Mol A


Example 1:
ShowHBoRes 20-30

Show hydrogen bonds within residues 20 to 30.


Example 2:
ShowHBoMol B,Extend=Yes

Show hydrogen bonds involving molecule B (by extending the selection to all hydrogen bonding partners of Mol B).



Example macro:

# EXAMPLE ShowHBo
Clear
LoadPDB 1crn
Pos Z=20
Clean
Style Stick
ColorHBo Yellow,Alpha=60
ShowHBo

Figure: Result of the example macro above.