Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ShowESP

-

Show electrostatic potential


CommandArgumentDatatypeDefault Min Max
Format: ShowESP Spacing = Grid spacing in in Å, FLOAT1.0- -
   min = Minimum absolute potential in %,FLOAT5.0--
  max = Maximum absolute potential*unit charge in EnergyUnits,FLOAT 0.0 --
  Water = Yes | NoSTRINGNo--
Python:result = ShowESP(spacing=None,Min=None,Max=None,water=None)
Menu:Analyze > Electrostatic potential
Related:Energy, Charge , PointPar
Required:


The ShowESP command creates a map of the electrostatic potential inside the simulation cell. Red dots indicate a negative, blue dots a positive potential.

The electrostatic potential can only be calculated if the soup is clean, a simulation Cell is present and its boundary is periodic. The cell should be neutral, otherwise PME artifacts will show up.

ShowESP uses the following procedure:
  • Assign atom charges using the current force field.
  • Perform a fast fourier transform to obtain the reciprocal space portion of the electrostatic Coulomb potential, following the Particle Mesh Ewald approach.
  • Loop over the grid points in the simulation cell and calculate the Coulomb potential. To avoid singularities near the atoms, only the smoothed reciprocal space potential is considered. If the absolute potential is larger than the chosen percentage (the min parameter) of the maximum absolute value in the cell, draw a dot. The maximum absolute value is either determined by YASARA or specified with the max parameter (in the current EnergyUnit). This parameter is ignored when set to zero.

Note that the electrostatic potential does currently not include implicit solvent molecules as known from Boundary Element or Poisson-Boltzmann methods.

Example 1:
ShowESP 1.5,min=10%

Show electrostatic potential at a 1.5 A grid, hiding those points where the potential is smaller than 10% of the maximum potential.


Example 2:
ShowESP 1.0,min=15%,max=50

Show electrostatic potential at a 1.0 A grid, hiding those points where the energy of a unit charge is smaller than 7.5 EnergyUnits (15% of 50 maximum). Energies >=50 units are colored blue, energies <= -50 units are colored red, all others are interpolated in between.


Example 3:
obj = ShowESP 1.0,min=15%,max=50,Water=Yes

As above, but do not ignore water molecules, and assign the number of the created object to variable 'obj'.



Example macro:

# EXAMPLE ShowESP
# Requires YASARA Dynamics
# EXAMPLE ShowESP
# Requires YASARA Dynamics
Clear
ForceField Amber96
LoadPDB 1crn
Clean
Style Ribbon,Stick
Cell 60,60,60
Boundary periodic
PointPar Radius=32,plastic=no
ShowESP Spacing=1.0,Min=20%
Pos -1,-1,30
Ori Alpha=-0.647,Beta=88.576,Gamma=-15.814

Figure: Result of the example macro above.