Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ShowDoc

-

Show documentation


CommandArgument DatatypeDefaultMinMax
Format:ShowDoc ---
Python:This command is mainly for internal use. It is not available in Python.
Menu:Help > Show documentation
Related: ShowCom , SearchDoc, PlayMovie
Required:


The ShowDoc command opens a web browser window and shows the YASARA documentation. To tell YASARA which browser to use, open the file yasara.ini in a text editor and modify the setting for 'BrowserPathLinux', 'BrowserPathMacOS' or 'BrowserPathWindows'.

There is currently no PDF version of the YASARA documentation for the following reasons:

  • The documentation is updated almost every week, so any printout would be obsolete immediately.

  • Navigating in a PDF is much harder than with the current web browser based system.

In case we missed a compelling reason for a PDF version, please tell us.

Example:
ShowDoc

Run the web browser to show the YASARA documentation.