Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ShowCone

-

Show a cone, cylinder, pyramid or prism


CommandArgumentDatatypeDefault Min Max
Format: ShowCone BottomRadius = Radius of cone bottom in Å,FLOAT10.0--
  TopRadius = Radius of cone top in Å ,FLOATBottom --
  Height = Height of cone in Å,FLOAT 10.0--
   Edges = Number of edges at top and bottom,INT12 - -
   BottomCol = Color of cone bottom, RGBCOLORRed - -
   TopCol = Color of cone top, RGBCOLORBottomCol - -
   SideCol = Color of cone side, RGBCOLORTopCol - -
   Smooth = Yes | NoSTRING Yes --
Python:result = ShowCone(bottomradius=None,topradius=None,height=None,edges=None,bottomcol=None,topcol=None,sidecol=None,smooth=None)
Menu:Effects > Show solid > Cone, pyramid, cylinder & prism
Related:ShowSphere, ShowBox, ShowTorus , MoveMesh
Required:


The ShowCone command creates a cone, cylinder, pyramid or prism, depending on the chosen parameters:

  • If 'BottomRadius' is the same as 'TopRadius', the result is a cylinder (Smooth=Yes) or prism (Smooth=No).

  • If either 'BottomRadius' or 'TopRadius' is zero, the result is a cone (Smooth=Yes) or pyramid (Smooth=No).

  • If 'BottomRadius' differs from 'TopRadius', the result is a truncated cone (Smooth=Yes) or truncated pyramid (Smooth=No).

  • If the 'BottomCol' or 'TopCol' is set to 'None', the corresponding side will be open.

  • The Edges parameter sets the number of edges that are used to approximate the bottom and top faces. The minimum number of three results in a tetrahedron or three-sided prism, four gives a four-sided pyramid or prism, and values >12 should be chosen to create a truly round shape, i.e. a cone or cylinder. In this case, 'Smooth' should also be set to 'Yes', so that the surface normals are adjusted to define a smooth, continuous face.

The created cone rotates around the origin of its local coordinate system , which is at the center of the cone. Use the MoveMesh command to shift the origin.

Example 1:
ShowCone BottomRadius=10,TopRadius=0,Height=15,Edges=4,BottomCol=Blue,SideCol=Red,Smooth=No

Show a 15 A high red four-sided pyramid with a blue base (20 A in diameter).


Example 2:
ShowCone BottomRadius=12,Height=50,Edges=20,BottomCol=Green,TopCol=Red,SideCol=Yellow

Show a cylinder with 24 A diameter, 50 A high, colored green, yellow and red.



Example macro:

# EXAMPLE ShowCone
# Requires YASARA Model
Clear
ColorBG 3030ff,a0a0e0,5050ff,c0c0ff
ColorFog c0c0ff
# Create the island
islandheight=20.
islandradius=200
ShowCone BottomRadius=(islandradius*1.5),TopRadius=(0.998*islandradius),Height=(islandheight),Edges=26,
         BottomCol=None,TopCol=c5a885,SideCol=c5a885
MoveObj Cone,Y=(-islandheight/2)
# Add the water
obj = ShowBox Width=1000,Height=2,Depth=1000,LeftCol=None,TopCol=4040ff,FrontCol=None
MoveObj (obj),Y=-10
# Create the floating matrass
matsegments=5
matsegradius=4.0
matlength=60
matcol='Green'
for i=0 to matsegments-1
  obj = ShowCone BottomRadius=(matsegradius),Height=(matlength),Edges=12,
                 BottomCol=None,SideCol=(matcol)
  dx=(1.50*matsegradius*((-0.5*(matsegments-1))+i))
  MoveMesh (obj),X=(dx)
  RotateObj (obj),X=90
  RenameObj (obj),Matrass
  for j=-1 to 1 step 2
    obj = ShowSphere Radius=(matsegradius),Color=(matcol),Level=2
    MoveMesh (obj),X=(dx),Z=(0.5*j*matlength)
    RenameObj (obj),Matrass
obj = ShowSphere Radius=(0.75*matsegradius*matsegments),Color=(matcol),Level=2,ScaleY=0.5,ScaleZ=0.5
MoveMesh (obj),Y=(1.50*matsegradius),Z=(0.5*matlength)
RenameObj (obj),Matrass
matshift=200
MoveObj Matrass,X=(matshift),Y=-10,Z=(-matshift)
AutoRotateObj Matrass,Y=0.5
# Define the look of a palm tree
stamheight=12.
stamradius=3.
stamsegments=8
crown=stamsegments
leafs=5
treeheight=stamheight*stamsegments
treeobjects=stamsegments+leafs
# Define the positions of the palm trees on the island
treeposx=00, -110,  70,  -90, -180, 130, 100
treeposz=40,   80, -60, -120,    0, 130, 0
trees=count treeposx
# Grow the palm trees
for i=1 to trees
  # Create the palm stam  
  for j=0 to stamsegments-1
    obj = ShowCone BottomRadius=(stamradius),TopRadius=(stamradius*2.0),Height=(stamheight),Edges=12,
                   BottomCol=None,TopCol=3a200a,SideCol=986c34
    MoveMesh (obj),Y=(stamheight*j)
    RenameObj (obj),Tree(i)(j)
  # Create the palm crown
  for j=1 to leafs
    obj = ShowSphere Radius=(stamradius*2.0),Color=3aae35,Level=2,ScaleY=0.8,ScaleZ=5
    RotateObj (obj),X=8,Y=(j*360/leafs)
    MoveMesh (obj),Y=(treeheight-0.5*stamheight)
    RenameObj (obj),Tree(i)(crown)
  # Move the tree to the final location
  MoveObj Tree(i)?,X=(treeposx(i)),Z=(treeposz(i))
Move -160,-26,300

Figure: Result of the example macro above.