Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ShowButton

-

Show clickable button


CommandArgument DatatypeDefaultMinMax
Format:ShowButton Text = Button text to showSTRING ---
Python: ShowButton(text)
Menu:Effects > Message > Show
Related: ShowMessage , HideMessage
Required:


The ShowButton command displays a button with the specified text. However, 'Continue' is the currently only supported button text.

As soon as the user clicks on the button, the Yanaconda variable 'ButtonTextButton' is set to true, e.g. 'ContinueButton':


ShowButton Continue
do
  Rotate Y=1
  Wait 1
while !ContinueButton


Example:
ShowButton Continue

Show a 'Continue'-button.