Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ShowBox

-

Show a rectangular box


CommandArgument DatatypeDefaultMinMax
Format:ShowBoxWidth = Box width in Å,FLOAT 10.0--
   Height = Box height in Å, FLOATWidth --
  Depth = Box depth in Å,FLOATHeight --
  LeftCol = Left face color, RGBCOLORRed--
  RightCol = Right face color,RGBCOLOR LeftCol--
  BottomCol = Bottom face color, RGBCOLORLeftCol - -
   TopCol = Top face color,RGBCOLOR BottomCol--
   FrontCol = Front face color,RGBCOLOR BottomCol--
   BackCol = Back face colorRGBCOLOR FrontCol--
Python: result = ShowBox(width=None,height=None,depth=None,leftcol=None,rightcol=None,bottomcol=None,topcol=None,frontcol=None,backcol=None)
Menu:Effects > Show solid > Box & cube
Related:ShowSphere, ShowCone , ShowTorus, MoveMesh
Required:


The ShowBox commands creates a box of the specified width, height and depth. Colors can be set independently for all 6 sides. If a color is set to 'None', the corresponding box side will be open.

The 'left' and 'right' faces point to the negative and positive X-axis. If YASARA is using a right handed coordinate system, these two faces will thus be flipped.

The created box rotates around the origin of its local coordinate system , which is at the center of the box. Use the MoveMesh command to shift the origin.

Example 1:
ShowBox Width=10,Height=15,Depth=30,LeftCol=Red

Create a red box 10x15x30 Angstrom large.


Example 2:
obj = ShowBox 5,7,9,LeftCol=Blue,BottomCol=Red,FrontCol=None,BackCol=Green

Create a box 5x7x9 A large, that is blue on the sides, red at the bottom and the top, green at the back - and open at the front so that you can look inside. The number of the new object is assigned to variable 'obj'.