Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Shell

-

Execute shell command


CommandArgument DatatypeDefaultMinMax
Format:ShellCommand STRING---
Python:This command is mainly for internal use. It is not available in Python.
Menu:This command is mainly useful for macros. There is no menu entry.
Related:PWD, CD , DelFile
Required:


The Shell command passes the specified instruction to the operating system for execution.

The output of the specified shell command is not displayed in YASARA's console but in the text console from where YASARA was run or stdout.txt in Windows. The Shell command is disabled in YASARA Movie for security reasons.

Example:
Shell dir

List directory.