Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SeqSelector

-

Switch sequence selector on/off


CommandArgumentDatatypeDefault Min Max
Format: SeqSelector Flag = On | OffSTRING ---
Python: SeqSelector(flag)
Menu:Window > Show sequence
Related: Menu , Console, HUD , FullScreen
Required:


The SeqSelector command toggles the display of the sequence selector at the bottom of the YASARA window.

Example 1:
SeqSelector Off

Do not show the sequence selector at the bottom of the YASARA window.


Example 2:
SeqSelector On 

Show it again as soon as the mouse pointer is above its position.