Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SecStr<Res|Mol|Obj|All>

-

Set/get secondary structure


CommandArgument DatatypeDefaultMinMax
Format:SecStr<Res|Mol|Obj|All> Selection, SELECTION- - -
   Type = Helix | Sheet | Turn | CoilSTRING ---
Python: SecStr<Res|Mol|Obj|All>(selection1,Type)
resultlist = SecStr<Res|Mol|Obj|All>(selection1)
Menu:View > Analyze > Secondary structure of
Related:ShowSecStr , HideSecStr, SecStrPar
Required:


The SecStr command either retrieves or changes YASARA's secondary structure assignment . It does not change the actual atom coordinates, i.e. to fold a beta strand into a helix, use the Dihedral command to set the Phi/Psi angles.

If you found a protein where YASARA's built-in secondary structure assignment algorithm does not give the expected result, please consider filing a problem report instead of fixing it with the SecStr command. More details can be found here .

Changes made with SecStr are temporary and disappear as soon as YASARA has to reassign the secondary structure, for example when atoms are deleted or the object is reloaded from disk. It is thus not possible to save the changes permanently.

When no secondary structure is specified, SecStrRes returns the secondary structure per residue as a list of the strings 'H', 'E', 'T' and 'C'. If the command extension is not 'Res', the total percentages of the secondary structure types are calculated and returned instead.

Hints for handling cyclic peptides can be found here .

If you want to use YASARA for large scale secondary structure assignment , with the goal to create secondary structure assignment files for many PDB files, simply run YASARA with these command line options:


yasara.exe -txt <NameOfPDBFile> secstr.mcr

Make sure to create the macro 'secstr.mcr' first, with the following content:


# Create a table with residue names and secondary structure assignments
Tabulate ListRes all,Format=RESNAME1
Tabulate SecStrRes all
# Save the table, using the name of the first object and extension .secstr
residues = CountRes all
name = NameObj 1
SaveTab default,./(name).secstr,Columns=(residues)
Exit

If you have a list of all PDB files , you can also loop over the list directly in YASARA:


for id in file pdbidlist.txt
  # Load the PDB file
  Clear
  LoadPDB (id)
  # Create a table with residue names and secondary structure assignments
  Tabulate ListRes all,Format=RESNAME1
  Tabulate SecStrRes all
  # Save the table, using the extension .secstr
  residues = CountRes all
  SaveTab default,./(id).secstr,Columns=(residues)

An example for more detailed secondary structure analysis , e.g. retrieving all interacting beta strands, can be found here .

Example 1:
SecStrRes 20-35,Helix

Set the secondary structure of residues 20-35 to helical.


Example 2:
SecStrMol B,Coil

Set the secondary structure of molecule B to coiled.


Example 3:
secstrlist() = SecStrRes Obj 1crn

Assign the secondary structure of the residues in object 1crn to 'secstrlist'.


Example 4:
SecStr

Display the percentages of secondary structure types in the soup.


Example 5:
helix,sheet,turn,coil = SecStrObj 5tim

As above, but for object 5tim only and assign the results to variables 'helix','sheet','turn','coil'.



Example macro:

# EXAMPLE SecStr
Clear
LoadPDB 1crn
Style Ribbon
for i=1 to 46 step 2
  ColorRes (i),yellow
  # Assign alternating Coil and Sheet structure
  SecStrRes (i),Coil
  SecStrRes (i+1),Sheet
Pos Z=21
Ori 52,326,-10  

Figure: Result of the example macro above.