Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SearchDoc

-

Search documentation


CommandArgument DatatypeDefaultMinMax
Format:SearchDoc Words to searchSTRING - --
Python:This command is mainly for internal use. It is not available in Python.
Menu:Help > Search documentation
Related: ShowDoc , ShowCom
Required:


The SearchDoc command searches the documentation for pages containing all the given words, ranks the hits and opens a result page in the default web browser.

Hints for searching:
  • The search terms are not case-sensitive.
  • The search terms do not have to be complete words, use singular instead of plural.
  • The search terms are automatically combined with a logical AND.
  • Quotes can be used to combine two or more words.

If you are looking for a PDF version of the documentation, click here.

Example 1:
SearchDoc soup

Search the documentation for all pages containing the word 'soup'.


Example 2:
SearchDoc force field parameters

Search the documentation for all pages containing the three words 'force', 'field' and 'parameters'.


Example 3:
SearchDoc display "bond order"

Search the documentation for pages containing the words 'display' and 'bond order'.