Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Your guide to YASARA View



° 

Essentials

-

What you really have to know


° 

Selections

-

Tell YASARA what you want


° 

Commands

-

Tell YASARA what to do


° 

Recipes

-

Answer complex questions


° 

Macros

-

Automate your work with Yanaconda


° 

Plugins

-

Extend YASARA with your own functions


° 

Scripts

-

Use YASARA as a Python module


° 

Windows users can obtain Python from www.python.org

° 

Copy and import yasara/pym/yasara.py

° 

There is a Python function wrapper for most YASARA commands

° 

Python functions return either nothing, a single value or a list

° 

YASARA specific data is available in 'info'

° 

YASARA commands with multiple formats map to different Python functions

° 

A subset of the YASARA soup can be obtained as a pdb_file instance

° 

The console needs to be switched off for maximum performance

° 

There is a specific Python function for each experiment

° 

The Python module can run YASARA in graphics or text mode


° 

Troubleshooting

-

Get things going