Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ScreenSize

-

Set/get window and fullscreen size


CommandArgumentDatatypeDefault Min Max
Format: ScreenSize X = Screen X-size in pixels,INT-- -
   Y = Screen Y-size in pixels INT-- -
Python:ScreenSize(x,y)
resultlist = ScreenSize()
Menu: Window > Size
Related:FullScreen, Screen, AtomSize
Required:


The ScreenSize command sets the size of the YASARA window. When YASARA is running fullscreen , ScreenSize will thus also change the actual screen resolution. If the specified resolution is not allowed, YASARA will set the closest one possible. YASARA stores the preferred ScreenSize in yasara.ini.

YASARA supports resolutions from minimally 640x480 up to maximally 2097152 pixels (e.g. 1680x1200 or 2048x1024 pixels). If your (combined) screen resolution is higher, it will not be possible to maximize the YASARA window, and going fullscreen will result in a red error box. The only workaround is to lower your screen resolution (e.g. via nvidia-settings if you own an nVIDIA card), at the cost of interpolation artifacts.

ScreenSize can also be used in console mode. Then the command sets the size of the virtual graphics window, which influences the aspect ratio of output created with SavePOV and RayTrace.

The currently maximum allowed ScreenSize is 1680x1200 pixels.

Example 1:
ScreenSize X=1024,Y=768

Choose a screen size of 1024x768 pixels.


Example 2:
x,y = ScreenSize

Get the current screen size and assign it to variables 'x' and 'y'.