Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

Screen

-

Fix YASARA window on a certain screen


CommandArgumentDatatypeDefault Min Max
Format: Screen Number = Screen numberINT- - -
Python: Screen(number)
Menu:Window > Fix on screen
Related: ScreenSize , FullScreen
Required:


The Screen command fixes the YASARA window on one of the connected screens. This command is currently only available in MacOSX.

The FullScreen video mode is only supported on the first screen.

Example 1:
Screen 1

Fix the YASARA window on the main screen.


Example 2:
Screen 2

Fix the YASARA window on the secondary screen.