Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

Your guide to YASARA View



° 

Essentials

-

What you really have to know


° 

Selections

-

Tell YASARA what you want


° 

Selections are defined by a final type and an expression

° 

Possible final selection types are All, Obj, Mol, Res and Atom

° 

Ranges can be specified with a minus sign

° 

A logical OR is assumed between items of the same selection type

° 

A logical AND is assumed if you switch the selection type

° 

Selections are inflated to the final selection type at the end

° 

Additional selection types allow to filter for various properties

° 

Names can be negated with an exclamation mark '!'

° 

Names can be wildcards using a question mark '?'

° 

Names with unusual characters can be quoted

° 

Selections can be combined with explicit operators


° 

The 'and', 'or' and 'not' operators perform logical operations

° 

The 'with distance <>X from' operator measures distances between atoms

° 

The 'with minimum distance from' operator finds the closest atom

° 

The 'with maximum distance from' operator finds the most distant atom

° 

The 'with <>X atoms closer Y among' operator counts close atoms

° 

The 'with <>X bonds to' operator analyzes bound atoms

° 

The 'with <>X bond angles to' operator analyzes second neighbor atoms

° 

The 'with distance <>X from Y surface...' operator measures distances from a surface

° 

The 'with contribution to X surface...' operator analyzes surface contributions

° 

The 'within sequence' operator selects within a given sequence

° 

Selections are not case sensitive except for two special cases

° 

Selection windows allow to build selections with the mouse

° 

Yanaconda helps to define selection subsets

° 

Examples of selections needed in real-life


° 

Commands

-

Tell YASARA what to do


° 

Recipes

-

Answer complex questions


° 

Macros

-

Automate your work with Yanaconda


° 

Plugins

-

Extend YASARA with your own functions


° 

Scripts

-

Use YASARA as a Python module


° 

Troubleshooting

-

Get things going