Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ScaleRest<Atom|Res|Mol|Obj|All>

-

Scale restraints


CommandArgument DatatypeDefaultMinMax
Format:ScaleRest<Atom|Res|Mol|Obj|All> Selection, SELECTION- - -
   Class = Restraint class name, STRINGAll - -
   Distance = Distance restraint scaling factor,FLOAT ---
   Dihedral = Dihedral restraint scaling factorFLOAT---
Python:ScaleRest<Atom|Res|Mol|Obj|All>(selection1,Class,distance,dihedral)
Menu:Simulation > Scale restraints
Related: ShowRest , HideRest, DelRest , ListRest, LoadTbl , RestrainDis, RestrainDih , RestrainPot, RestrainPar , RestEnergy, RestViol
Required:and the NMR Structure Determination Module


The ScaleRest command sets the scaling factors for distance and dihedral angle restraints involving one of the selected atoms and belonging to the selected class.

The current scaling factors are shown by the ListRest command.

The Class parameter allows to select a certain restraint class. In addition to class names specified when loading the restraints , the built-in names 'Violate' and 'Fulfill' select violated and fulfilled restraints respectively.

Example 1:
ScaleRestAll Distance=25,Dihedral=10

Set scaling factors for all distance and dihedral restraints to 25 and 10 respectively.


Example 2:
ScaleRestMol A,Class=Ambig,Distance=15

Set the scaling factor for distance restraints in molecule A belonging to class 'Ambig' to 15.


Example 3:
ScaleRestAtom Sidechain Res Arg,Distance=8

Set the scaling factor for distance restraints involving Arg side-chains to 8.