Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

ScaleForce

-

Set/get force scaling factors


CommandArgumentDatatypeDefault Min Max
Format: ScaleForce Component = Bond | Angle | Dihedral | Planarity | Nonbonded | All, STRING---
  Factor = Force scaling factor FLOAT-0.01000.0
Python:ScaleForce(component,factor)
resultlist = ScaleForce()
Menu:Simulation > Scale forces
Related:Force, Interactions
Required:


The ScaleForce command scales the selected interaction type during a simulation. Only forces, but not energies are affected by this command.

The major field of application is NMR structure determination, where scaling up bond and angle or planarity forces helps to preserve the local geometry, even if some restraints cannot be satisfied. Scaling down non-bonded (VdW and Coulomb) forces allows parts of the peptide chain to pass through each other, resolving knots and other kinetic traps.

Instead of scaling an interaction type with 0, it should be taken out of the force field completely , which lets YASARA run faster (especially when non-bonded interactions are removed).

When using the NOVA force field , the scaling factors for bond angles and dihedral angles are ignored (bond angles are treated like normal bonds, and dihedral angles via non-bonded forces).

While the 'Energy Planarity' command returns the improper dihedral energy for consistency with other programs, 'ScaleForce Planarity' additionally scales proper dihedrals that are part of planar groups.

The ForceField and Reset commands set all scaling factors back to 1.0.

Example 1:
ScaleForce

Display current force scaling factors.


Example 2:
ScaleForce Bond,2.0

Scale bond stretching force constants with 2.0.


Example 3:
ScaleForce Angle,0.5

Scale angle bending force constants with 0.5.


Example 4:
ScaleForce Dihedral,5

Scale dihedral angle barriers with 5.


Example 5:
ScaleForce Planarity,10

Scale the out of plane bending forces with 10.


Example 6:
ScaleForce NonBonded,0

Ignore all non-bonded interactions (better use Interactions , which is faster).