Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SaveYOb

-

Save YASARA object


CommandArgument DatatypeDefaultMinMax
Format:SaveYObObject selection, SELECTION---
  Filename = YASARA object filename STRING- - -
Python: SaveYOb(selection1,filename)
Menu:File > Save as > YASARA object
Related:SavePDB, SaveSce , Save*, LoadPDB
Required:


YOb files are flat binary files that can be rapidly processed by YASARA, are 50% smaller than a comparable PDB file and contain specific features like labels or arrows that cannot be stored in normal PDB files. YOB files contain just one object, use SCE files to load/save the entire scene. Also use SCE files to save objects that are not molecules (e.g. arrows, table graphs).

Example:
SaveYOb 2,1crn

Save object 2 as yob/1crn.yob (or just 1crn.yob if subdirectory yob is not present).