Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SaveXTC

-

Save simulation snapshots in XTC format


CommandArgumentDatatypeDefault Min Max
Format 1:SaveXTC Filename = Trajectory filename,STRING ---
   Steps = Number of simulation cycles between snapshots INT ---
Format 2: SaveXTCOff STRING---
Python:SaveXTC(filename,steps)
SaveXTCOff()
Menu:File > Save as > Simulation snapshot
Related:LoadXTC, SaveSim , LoadSim, Sim
Required:


The SaveXTC command periodically saves a snapshot of a running simulation (consisting of atom positions only). These snapshots can be used to analyze a simulation or play it back quickly.

The XTC format has been optimized by the GROMACS team for minimum space requirements. The format does not store atom velocities, use SaveSim if you also want to save those to continue a simulation after power failures. Another option is to use both SaveSim and SaveXTC commands together, with a larger save interval for SaveSim .

An XTC trajectory is one big single file, which prohibits random access for writing. If you try to save a snapshot to an XTC file that already contains a snapshot with the same number, the command is ignored. To avoid an unrecoverable mess of snapshots, it is also required that they are written with sequential numbers. Snapshot numbers are not specified explicitly but calculated internally from the current simulation time. The simulation time should therefore be set to 0 before the SaveXTC command is run, otherwise YASARA complains if the trajectory does not yet contain snapshots ('premature end of file encountered').

In Windows, XTC files can currently not be handled correctly if they grow beyond the size limit of 2 Gigabytes.

If you want to load the XTC file in another program for analysis , you will usually also need a PDB file with all the atoms taking part in the simulation, appearing in the same order as their coordinates in the XTC file. To create such a PDB file, load the starting scene (usually with _water extension), then join the objects containing atoms (often solute and solvent are in different objects) to the first object and finally save the resulting single object in PDB format .

While the XTC format in principle supports different precisions for storing atom coordinates, technical reasons require YASARA to always store coordinates with its own internal precision, i.e. 1e-6 (femtometers).

To convert a list of PDB files to an XTC trajectory , you can use the following macro:


# Convert PDB files to a SIM or XTC trajectory
# This example assumes that the PDB files are stored as 1crn_00.pdb, 1crn_01.pdb etc..
name='1crn_'
number=00
# Set the timestep between simulation snapshots in [fs], e.g. 5 picoseconds
steps=5000
# Set the trajectory format (SIM,XTC)
format='XTC'
# Load the first protein
Clear
LoadPDB (name)(number)
Clean
# Create a cell, force field does not matter, but TimeStep is important
Cell Auto,Extension=10
ForceField Amber99
TimeStep 1,1
TempCtrl SteepDes
# Start saving the trajectory
Save(format) (name)(number),Steps=(steps)
# Loop over the PDB files
Console Off
while 1
  # Next PDB file present?
  found = FileSize (name)(number).pdb
  if not found
    break
  # Load it, and replace the previous one
  ShowMessage 'Converting snapshot (number)...'
  new = LoadPDB (name)(number)
  CleanObj (new)
  SupObj (new),1
  SwapObj (new),1
  DelObj (new)
  # To save the snapshot, we start a simulation and set the simulation time
  # to the point when the next trajectory snapshot will be saved automatically.
  Sim On
  Time (number*steps)
  # Wait for one simulation cycle, so that the MD engine has the time to save.
  Wait 1
  Sim Off
  # Next snapshot
  number=number+1


Example 1:
SaveXTC 1crn,2500

Save simulation snapshots every 5ps (if time step is 2*1fs) in file sim/1crn.xtc (or just 1crn.xtc if subdirectory sim is not present).


Example 2:
SaveXTC Off

Disable saving of snapshots in XTC format.