Endonuclease PvuII (1PVI) DNA - GATTACAGATTACA
CAP - Catabolite gene Activating Protein (1BER)
DNA - GATTACAGATTACAGATTACA Endonuclease PvuII bound to palindromic DNA recognition site CAGCTG (1PVI) DNA - GATTACAGATTACAGATTACA TBP - TATA box Binding Protein (1C9B)
CAP - Catabolite gene Activating Protein (1BER)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
GCN4 - leucine zipper transcription factor bound to palindromic DNA recognition site ATGAC(G)TCAT (1YSA)
TBP - TATA box Binding Protein (1C9B)
 

° 

SaveTbl

-

Save XPLOR distance and dihedral angle restraints


CommandArgument DatatypeDefaultMinMax
Format:SaveTblObject selection, SELECTION---
  Filename = Restraint table filename,STRING ---
   Component = All | Distance | Dihedral STRING-- -
Python:SaveTbl(selection1,filename,component)
Menu:This command is mainly useful for macros. There is no menu entry.
Related:RestrainDis, RestrainDih, RestrainPot , RestrainPar, ScaleRest , ShowRest, HideRest , DelRest, ListRest
Required:and the NMR Structure Determination Module


The SaveTbl saves the NMR restraints in the selected objects as an XPLOR restraint file.

The details of the output format are described at the LoadTbl command.

Example 1:
SaveTbl 3gb1,restraints

Save the restraints associated with object 3gb1 as dat/restraints.tbl (or just restraints.tbl if subdirectory dat is not present).


Example 2:
SaveTbl 3gb1,distance,Component=Distance

As above, but choose the filename distance.tbl and save only the distance restraints.